BLIGHTED BY KENNING

Installation, 2011

Charlotte Jarvis (UK)

Blighted by Kenning centres on bioengineered bacteria that has The Universal Declaration of Human Rights encoded into its DNA. The DNA was extracted from the bacteria and used to ‘contaminate’ apples grown at The Hague, the seat of the International Courts of Justice. These ‘forbidden fruits’ were then sent to genomics laboratories around the world. Participating scientists were asked to sequence the DNA, find the message hidden within and send back a translation. They were also invited to eat the fruit.

The process for encoding text into DNA is not new. Each letter of the alphabet is represented by one DNA codon: a tri-nucleotide unit consisting of a specific combination of adenine (A), thymine (T), guanine (G) and cytosine (C). Helpfully, most codons already correspond to an existing amino acid, each of which is designated by a single letter of the alphabet, known as the single-letter code. Because not all letters are represented by amino acids, but some amino acids are encoded by multiple codons, it was necessary to slightly adapt the ‘meaning’ of some codons. For example, the words “Article One” are written into the genome as “GCTCGTACTATTTGTTTAGAAAGAATAAATGAA”, where the codon AGA is used to designate a space and the codon ATA is used for the letter O, which has no associated amino acid. Once the DNA was sequenced, it was extracted from the bacteria and made into a solution which was sprayed onto the surface of the apples. In nature, amino acids are strung together to make proteins. Therefore, when a DNA code for The Universal Declaration of Human Rights is made, a hypothetical ‘human rights protein’ is also produced.

The structure of this protein has been visualised as part of the project. Although inherently political, the work does not take sides. The agenda is not to trumpet human rights nor GM foods, but instead to examine the way in which intellectual progress and scientific knowledge are infectious. The apple, one of the most cultivated fruits in the world, symbolises knowledge, temptation, and sin. It is the ideal carrier, and by literally contaminating the ‘forbidden fruit’ with knowledge, Blighted by Kenning challenges the concept of whether knowledge can ever be evil. In eating the infected apples, scientists around the world are given the opportunity to affirm their belief in their field and consequently in intellectual progress.

Artist's Statement

Blighted by Kenning proposes an alternative scenario to those usually associated with GM foods. By reversing the idea of forbidden fruit, it seeks to directly challenge some of the religious rhetoric that is employed in the press when reporting on GM issues. In the Book of Genesis, knowledge leads to evil and suffering. My belief is that the abstract pursuit of knowledge (including synthetic biology and GM research) can never be ‘evil’ — it is how we choose to apply that knowledge that can be dangerous, but not the knowledge itself. The purpose of creating and ultimately consuming ‘apples of knowledge’ is to assert that belief and to allow scientists working in these controversial fields to publicly ‘put their money where their mouth is’.